taqman mirna rt-qpcr method (Thermo Fisher)

Thermo Fisher is a verified supplier

Thermo Fisher manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Thermo Fisher taqman mirna rt-qpcr method
Taqman Mirna Rt Qpcr Method, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rt-qpcr+method/pm39859445-166-6-10
Average 90 stars, based on 1 article reviews

taqman mirna rt-qpcr method - by Bioz Stars, 2026-10

90/100 stars

Images

Real-time Polymerase Chain Reaction:

Article Title: Single-cell RNA sequencing of human epidermis identifies Lunatic fringe as a novel regulator of the stem cell compartment
Article Snippet: .. Supplemental Table 1 - TaqMan probes used for the qPCR reactions (related to Experimental Procedures) Gene Name Gene Symbol TaqMan Assay ID Delta-Like Ligand 1 DLL1 Hs.379912_m1 Glyceraldehyde-3-phosphate dehydrogenase GAPDH Hs02758991_g1 Hes family bHLH transcription factor 1 HES1 Hs00172878_m1 Hes family bHLH transcription factor 2 HES2 Hs01021800_g1 Hes family bHLH transcription factor 4 HES4 Hs00970270_g1 Hes family bHLH transcription factor 5 HES5 Hs01387463_g1 Hes family bHLH transcription factor 6 HES6 Hs05043218_s1 Hes family bHLH transcription factor 7 HES7 Hs00261517_m1 Hes related family bHLH transcription factor with YRPW motif 1 HEY1 Hs01114113_m1 Interferon regulatory factor 6 IRF6 Hs01062178_m1 Involucrin IVL Hs00846307_s1 Jagged 1 JAG1 Hs01070032_m1 Jagged 2 JAG2 Hs00171432_m1 Lunatic Fringe LFNG Hs00385436_g1 Manic Fringe MFNG Hs00159117_m1 Radical Fringe RFNG Hs01357010_g1 Ribossomal protein S18 RPS18 Hs01375212_g1 TATA-box binding protein TBP Hs00427620_m1 Tumor protein p63 TP63 Hs00978340_m1 Hes related family bHLH transcription factor with YRPW motif 2 HEY2 Hs01012057_m1 Hes related family bHLH transcription factor with YRPW motif-like HEYL Hs01113778_m1 Supplemental Table 2 - Primer pairs used in SYBR green RT qPCR reactions (related to Experimental Procedures) Gene Name Gene Symbol Primer Forward Primer Reverse Hes family bHLH transcription factor 1 HES1 AAAAATTCCTCGTCCCCGGT ATGCCGCGAGCTATCTTTCT Ribossomal protein S18 18sRNA GCAATTATTCCCCATGAACG GGCCTCACTAAACCATCCAA DeltaNp63 - p63 isoform dNtp63 TCCTCAGGGAGCTGTTATCC TGACTAGGAGGGGCAATCTG Dual Specificity Phosphatase 6 DUSP6 ACCTGGAAGGTGGCTTCAGT CTCGGTCAAGGTCAGACTCG Hes related family bHLH transc. factor with YRPW motif1 HEY1 GTTCGGCTCTAGGTTCCATGT CGTCGGCGCTTCTCAATTATTC Interferon regulatory factor 6 IRF6 GCTCTCTCCCAATGACCTGGA CCATGACGTCCAGCAGCTTGCTA Integrin subunit alfa 6 ITGA6 CGCTGGGATCTTGATGCTTGCT TGAGCATGGATCTCAGCCTTGTGA Integrin subunit beta 1 ITGB1 GACGCCGCGCGGAAAAGATG ACCACCCACAATTTGGCCCTGC Involucrin IVL TCCTCCAGTCAATACCCATC CAGCAGTCATGTGCTTTTCCT Notch Receptor 1 NOTCH1 TCCACCAGTTTGAATGGTCA AGCTCATCATCTGGGACAGG Notch Receptor 2 NOTCH2 GATCACCCGAATGGCTATGAAT GGGGTCACAGTTGTCAATGTT Notch Receptor 3 NOTCH3 TGGCGACCTCACTTACGACT CACTGGCAGTTATAGGTGTTGAC Notch Receptor 4 NOTCH4 TGTGAACGTGATGTCAACGAG ACAGTCTGGGCCTATGAAACC NUMB, endocytic adaptor protein NUMB GGCATACAGAGGTTCCTACA TGCTCCTTTGACCGCTAC Periplakin PPL GCAGAGTGACCTGGCTCGGCT GCCGCATCCGCCTCTAGCAC TATA-box binding protein TBP GTGACCCAGCATCACTGTTTC GAGCATCTCCAGCACACTCT Transglutaminase 1 TGM1 GCACCACACAGACGAGTATGA GGTGATGCGATCAGAGGAT ..

TaqMan Assay:

Binding Assay:

SYBR Green Assay:

Quantitative RT-PCR:

other:

Article Title: Modification in mitochondrial function is associated with the FADS1 variant and its interaction with alpha-linolenic acid-enriched diet-An exploratory study.
Article Snippet: The respiration data was normalized by the total DNA content of cells (CyQUANT Cell Proliferation Assay, Thermo Scientific). mtDNA analysis The total DNA, including mitochondrial DNA (mtDNA), was extracted using the DNeasy Blood & Tissue Kit (Qiagen), as described earlier (31). mtDNA was quantified with the standard curve method using RT-qPCR (QuantStudio 6 Pro, Applied Biosystems) with primers for three different mtDNA genomic regions (16S rRNA, CYTB, and D-loop) and for three nuclear DNA (ncDNA) regions (APP, HBB, and B2M).

Article Title: Soy Isoflavone Genistein Enhances Tamoxifen Sensitivity in Breast Cancer via microRNA and Glucose Metabolism Modulation.
Article Snippet: MiRNA expression was quantified with the TaqMan miRNA RT-qPCR method (Applied Biosystems, Houston, TX, USA) on a CFX96 real-time PCR detection system (Bio-Rad, Hercules, CA, USA).

Article Title: Ramadan fasting model modulates biomarkers of longevity and metabolism in male obese and non-obese rats.
Article Snippet: The RT-qPCR procedure was subsequently performed, utilizing Applied Biosystems™ to amplify specific cDNA targets.

Article Title: Evaluation of Cinnamon Essential Oil and Its Emulsion on Biofilm-Associated Components of Acinetobacter baumannii Clinical Strains.
Article Snippet: Gene expression was determined using the RT-qPCR method (Step One Plus, Real Time PCR System, Applied Biosystems, Waltham, MA, USA).

Article Title: Genetic Alterations in a Large Population of Italian Patients Affected by Neurodevelopmental Disorders.
Article Snippet: RT-qPCR was performed using the SYBR Green method and implemented in the Applied Biosystems 7900HT Fast Real-time PCR system, following the manufacturer’s protocol (Applied Biosystems, Life of technologies).

Review